What I cannot create, I do not understand--- Richard Feynman
George Church deeped dived into three SynBio projects: Multiplex synthetic libraries & selections, Recoding: resistance to all viruses and Editing repeats.
Design a mutation in any gene of a mammalian or plant of your choice*. In order to design a genomic modification, you will need to know the gene sequence you want to modify. At the end of the document is a short selection of organisms with published genomes, but you can also take the gene sequence of the organism you want to work in from elsewhere.
1.) Overview and rationale: In a short paragraph, describe the type of mutation you want to introduce and the rationale behind it. For inspiration, you can take a look at Prof. Church’s list of potential human genome modifications, browse in one of the functional databases, or look through published experiments.
<aside> 🧬 Harvard Molecular Technologies- Prof. Church’s list https://arep.med.harvard.edu/gmc/protect.html
</aside>
The Gene I choose is "CCR5" from Geroge Church's list of Harvard Molecular Technologies, and because it is regarding HIV resistance.
2.) Genomic sequence: Include the genomic sequence you want to modify in your write up. You don’t need to paste the full sequence; just include the part relevant for designing your editing experiment!
Below is the sequence extracted from Exon 1.
ACTTAATGATTTAACTCCACCCTCCTTCAAAAGAAACAGCATTTCCTACTTTTATACTGTCTATATGATTGATTTGCACAGCTCATCTGGCCAGAAGAGCTGAGACATCCGTTCCCCTACAAGAAACTCTCCCCG
3.) Genome editor design: Describe which genome editing tool you want to use and submit your design.
Here are my three selected gRNA sequences along with characteristics: